 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circMYLK | |||
| Gene | MYLK | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Prostate Cancer | ICD-10 | Malignant neoplasm of prostate (C61) |
| DBLink | Link to database | PMID | 29798970 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | Seventeen paired PCa and matched non-tumor normal tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CAGTGCATGCTGTTTGTTCA Reversetcggagccttgacttccag | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Dai, Y, Li, D, Chen, X, Tan, X, Gu, J, Chen, M, Zhang, X (2018). Circular RNA Myosin Light Chain Kinase (MYLK) Promotes Prostate Cancer Progression through Modulating Mir-29a Expression. Med. Sci. Monit., 24:3462-3471. | |||